A Brief History Of Creation

The epic story of the scientists through the ages who have sought answers to life’s biggest mystery: How did it begin? In this essential and illuminating history of Western science, Bill Mesler and H. James Cleaves II seek to answer the most crucial question in science: How did life begin? They trace the trials and triumphs of the iconoclastic scientists who have sought to solve the mystery, from Darwin’s theory of evolution to Crick and Watson’s unveiling of DNA. This fascinating exploration not only examines the origin-of-life question, but also interrogates the very nature of scientific discovery and objectivity.

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Contemporary poetry from a Jewish perspective based on the Book of Genesis

Originally published in 1899, The History of Creation was the first book of its kind to apply a doctrine to the whole range of organic morphology and make use of the effect Darwin had on biological sciences during the 19th century. Haeckel looks at Darwin’s reform of Descent Theory and its establishment through the doctrine of selection. He introduces Descent Theory into the systematic classification of animals and plants and finds a "natural system" on the basis of genealogy - that is, to construct hypothetical pedigrees for the various species of organisms. The book will be of interest to those studying natural history and the origins of modern scientific thought, it will appeal to researchers both in the natural sciences and in history.

The war of 1971 that created Bangladesh was the most significant geopolitical event in the Indian subcontinent since partition in 1947. It tilted the balance of power between India and Pakistan steeply in favor of India. Srinath Raghavan contends that the crisis and its cast of characters can be understood only in a wider international context.

Authoritative yet accessible historical overview of Christian Sunday worship In this book noted Christian historian Justo Gonzalez tells the story of how and why Christians have worshiped on Sunday from the earliest days of the church to the present. After discussing the views and practices relating to Sunday in the ancient church, Gonzalez turns to Constantine and how his policies affected Sunday observances. He then recounts the long process, beginning in the Middle Ages and culminating with Puritanism, whereby Christians came to think of and strictly observe Sunday as the Sabbath. Finally, Gonzalez looks at the current state of things, exploring especially how the explosive growth of the church in the Majority World has affected the observance of Sunday worldwide. Readers of this book will rediscover the joy and excitement of Sunday as the early church celebrated it and will find inspiration in an age of increasing indifference and hostility to Christianity."

The History of Creation is a book by German scientist Ernst Haeckel, which deals with issues of creation and evolution under influence of Charles Darwin. The book did a great deal to further explain "Darwinism" and widens the theory to the world. Haeckel argued that human evolution consisted of precisely 22 phases, the 21st – the "missing link" – being a halfway step between apes and humans. He even formally named this missing link Pithecanthropus alalus, translated as "ape man without speech"