A Brief History Of Creation Science And The Search For The Origin Of Life

The epic story of the scientists through the ages who have sought answers to life’s biggest mystery: How did it begin? In this essential and illuminating history of Western science, Bill Mesler and H. James Cleaves II seek to answer the most crucial question in science: How did life begin? They trace the trials and triumphs of the iconoclastic scientists who have sought to solve the mystery, from Darwin’s theory of evolution to Crick and Watson’s unveiling of DNA. This fascinating exploration not only examines the origin-of-life question, but also interrogates the very nature of scientific discovery and objectivity.

What is life? Humans have been asking this question for thou­sands of years. But as technology has advanced and our understanding of biology has deepened, the answer has evolved. For decades, scientists have been exploring the limits of nature by modifying and manipulating DNA, cells and whole organisms to create new ones that could never have existed on their own. In Creation, science writer Adam Rutherford explains how we are now radically exceeding the boundaries of evolution and engineering entirely novel creatures—from goats that produce spider silk in their milk to bacteria that excrete diesel to genetic circuits that identify and destroy cancer cells. As strange as some of these creations may sound, this new, synthetic biology is helping scientists develop radical solutions to some of the world’s most pressing crises—from food shortages to pandemic disease to climate change—and is paving the way for inventions once relegated to science fiction. Meanwhile, these advances are shedding new light on the biggest mystery of all—how did life begin? We know that every creature on Earth came from a single cell, sparked into existence four billion years ago. And as we come closer and closer to understanding the ancient root that connects all living things, we may finally be able to achieve a second genesis—the creation of new life where none existed before. Creation takes us on a journey four billion years in the making—from the very first cell to the ground-breaking biological inventions that will shape the future of our planet.

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

What is life? Where do we come from and how did we evolve? What is the universe and how was it formed? What is the nature of the material world? How does it work? How and why do we think? What does it mean to be human? How do we know? There are many different versions of our creation story. This book tells the version according to modern science. It is a unique account, starting at the Big Bang and travelling right up to the emergence of humans as conscious intelligent beings, 13.8 billion years later. Chapter by chapter, it sets out the current state of scientific knowledge: the origins of space and time; energy, mass, and light; galaxies, stars, and our sun; the habitable earth, and complex life itself. Drawing together the physical and biological sciences, Baggott recounts what we currently know of our history, highlighting the questions science has yet to answer.

How did life emerge on Earth? Is there life on other worlds? These questions, until recently confined to the pages of speculative essays and tabloid headlines, are now the subject of legitimate scientific research. This book presents a unique perspective--a combined historical, scientific, and philosophical analysis, which does justice to the complex nature of the subject. The book's first part offers an overview of the main ideas on the origin of life as they developed from antiquity until the twentieth century. The second, more detailed part of the book examines contemporary theories and major debates within the origin-of-life scientific community. Topics include: Aristotle and the Greek atomists' conceptions of the organism Alexander Oparin and J.B.S. Haldane's 1920s breakthrough papers Possible life on Mars?

A textbook which analyzes two theories of the origin of life and presents arguments supporting each one.

"Some have argued that life began in the chemical-rich seas of the early Earth, the famous primordial soup, while others are convinced that life began in strange vents pumping hot water out of the sea floor, where the chemical reactions that sustain living cells could get started. Or perhaps life began in volcanic ponds on land, or in meteorite impact zones, or even in beds of clay. Each idea has attracted staunch believers who promote it with an almost religious fervor. But the story of life's origins is more than this: it is a story that takes in some of the greatest discoveries in modern biology, from cells to DNA, and evolution to life's family tree. This book is the first full history of the scientists who struggled to explain one of the greatest mysteries of all: how and why life began"--

This edition of Science and Creationism summarizes key aspects of several of the most important lines of evidence supporting evolution. It describes some of the positions taken by advocates of creation science and presents an analysis of these claims. This document lays out for a broader audience the case against presenting religious concepts in science classes. The document covers the origin of the universe, Earth, and life; evidence supporting biological evolution; and human evolution. (Contains 31 references.) (CCM)